1. Explain in general terms the process of DNA replication.
DNA replication refers to the process whereby DNA makes its own copy during the process of cell division. During this process, the DNA strands unzip themselves since helicase enzyme breaks the hydrogen bonds between the complementary strands. As this occurs, a replication fork is created. Each individual strand (leading and lagging) will be used as templates. A primer attaches itself to the leading strand and the synthesis of DNA begins, whereby DNA polymerase adds nucleotides to the synthesized strand. This is a continuous process and occurs in 5’ to 3’ direction. Additionally, other primers bind at the lagging strands at several positions along the strand and Okazaki fragments are then added. This is a discontinuous process that takes place in 3’ to 5’ direction. The new strand is normally proofread before DNA ligase binds the two formed strands into complementary double strands.
2. What are the major events that occur at each stage in mitosis
At the prophase stage, there is the formation of spindle fibers, sister chromatids pair, and the cell nucleus disappears. At the metaphase stage, there is an alignment of the sister chromatids along the cell’s equator. This then enables attachment of spindle fibers to the centromeres of the sister chromatids. During the anaphase stage, there is a separation of sister chromatids via the centromere towards poles of the cell by spindle fibers. At the telophase stage, chromosomes that are the cell poles unwind to form DNA strands. There is also the appearance of nuclear membrane and the disappearance of spindle fibers. The last stage is cytokinesis where the cell splits and two daughter cells are formed.
3. Compare and contrast mitosis and meiosis.
They are both cell division processes and result to daughter cells that are identical. However, mitosis process results to two diploid cells while meiosis process results to four haploid cells. In meiosis, the cells formed have half the chromosome number of their parent whereas, in mitosis, the formed cells have an equal number of chromosomes as their parent. In meiosis, there is usually a crossing over whereas in mitosis there is no crossing over.
4. Explain biological magnification.
Biological magnification refers to a process whereby harmful chemicals or substances that move up food chains, resulting in them being fed on by fish or aquatic organisms, which are in turn fed on by humans or other animals. This causes an increase in harmful substances or chemicals in tissues of higher organisms in a food chain.
5. From an ecological point of view, how would you explain the famine in northern Africa?
Famine in Northern Africa is due to depletion of natural resources due to the livelihood of people in this area. For instance, the large population has led to increasing need of food that has resulted to people practicing poaching, deforestation and improper use of lands. this means that food chains will be interfered with, as well as energy flow. This results in an ecological imbalance in Northern Africa and famine occurs as a result.
6. Pick an ecological issue to discuss. Include in your discussion possible solutions to the problem.
An ecological issue is global warming. Global warming refers to increase in atmospheric temperature. This has been caused by industrial revolution and the increased carbon dioxide due to the burning of fossils used for fuel. Global warming has led to crops withering and dying thereby interfering with food chains. It has also caused the death of some animals that are unable to withstand the increased temperatures and occurrence of natural calamities. This can be prevented by use of energy saving appliances and lamps, recycling resources and reducing greenhouse emissions.
7. Describe the factors that influence the biotic potential of a particular species.
Factors that affect the biotic potential of a species include disease, predation, undesirable genetic traits, and competition. Increased predation will decrease the population. The competition will result in the survival of the fittest. Diseases can reduce the population and undesirable genetic traits can cause extinction.
8. If a women's father is color blind, what is the probability that her son will be color blind? What is the probability that her son's daughter will be colorblind? Color blindness is X-linked inheritance.
The probability is 50%
9. In humans, freckles are dominant to no freckles. A man with freckles is married to a woman with freckles, but the children have no freckles. What is the deal? (Assume no indiscretions have occurred).
The children are all carriers of the freckles disease.
10. Determine the protein (amino acid sequence) from the following mRNA.
5’ AUGGCUUUCCUAAUAUAACAUAUC 3’
MET-ALA-PHE-LEU-ILE-STOP-HIS-ILE
11. Explain the difference between sex-linked and sex-influenced inheritance.
Sex-linked inheritance usually refers to passing on of genes from parents to offspring’s (inheritance) in a certain way, due to mutated genes found at Y or X chromosomes. Se- influenced inheritance refers to the passing of genes from parents to offspring’s autosomally, though there exist different expression intensities in both males and females. An example is male baldness pattern.
12.The inheritance pattern represented by blackened squares and circles (symbolizing the same trait in different families; see the accompanying figure) may be assumed to depend on a single autosomal dominant or a single autosomal recessive gene. (a) Indicate which is the most likely mode of inheritance for the trait. (b) Based on your answer to (a), symbolize the probable genotype for each individual in each of the four pedigrees.
the trait is autosomal recessive.
Parents are XnY and XnXN
Offsprings are XNY, XnY, XNXn, XnXn
Parents are XNY and XnXN
Offsprings are XNXn, XnY, XNXn XnY,
Parents are XNY and XnXN
Offsprings are XNY, XNY, XnXn, XnXn
Parents are XnY and XnXn
Offsprings are XnY, XnY, XnXn, XnXn
Bonus: A family has 8 children, what is the probability that 4 of the children are Girls and 4 of the children are boys?
Punnet square
The probability is 50%
